circad | circRNAs associated with diseases

hsa_circ_0026143
Gene	TROAP	Organism	Human
Genome Locus	chr12:49722709-49723237:+	Build	hg19
Disease	Ovarian Endometriosis	ICD-10	Endometriosis of ovary (N80.1)
DBLink	Link to database	PMID	29334789
Experimental Method
Sample Type	Serum sample	Comparison	Twenty-four pairs of snap-frozen cyst walls of ovarian endometriomas and matched EU from the same patient were recruited with a laparoscopic and histological diagnosis of stage III-IV endometriosis
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCGTCTCACCGTTCAACCTAA Reverse CATCAGGTGGGAGTCATGGCT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Shen, L, Zhang, Y, Zhou, W, Peng, Z, Hong, X, Zhang, Y (2018). Circular RNA expression in ovarian endometriosis. Epigenomics, 10, 5:559-572.